View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3857_low_49 (Length: 270)
Name: NF3857_low_49
Description: NF3857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3857_low_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 261
Target Start/End: Complemental strand, 2556119 - 2555876
Alignment:
| Q |
19 |
gctatccaattgagaaagtgaaacatgaagctggagatttatttcggtggtttcttccattacgacgatgttaaggacaaccatggaagcggcaactatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2556119 |
gctatccaattgagaaagtgaaacatgaagctggagatttatttcggtggtttcttccattacgacgatgttaaggacaaccatggaagcggcaactatg |
2556020 |
T |
 |
| Q |
119 |
gattcatcaccggtgagaatggtcttgccctttgttttctagaagacacgttagattttgggagagagagaaattcgtgaagacgtagtga-nnnnnnnn |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2556019 |
gattcatcaccggtgagaatggtcttgccctttgttttctagaagacacgttagattgtgggagagagagaaattcgtgaagacgtagtgattttttttt |
2555920 |
T |
 |
| Q |
218 |
cctgctctatttagcattatgtttcttcaatgccatatctctgc |
261 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2555919 |
tccgctctatttagcattatgtttcttcaatgccgtatctctgc |
2555876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University