View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3857_low_50 (Length: 267)
Name: NF3857_low_50
Description: NF3857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3857_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 22 - 253
Target Start/End: Complemental strand, 38884320 - 38884089
Alignment:
| Q |
22 |
atttttaactcttacactaacatgaaaaaaccaagggatcggactcaaatgtttaatgcatttcagttaaagacgaatcgtttggttgaatccgagttca |
121 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38884320 |
atttttaactcttatactaacatgaaaaaaccaagggatcggactcaaatgtttaatgcatttcagttaaagacgaatcgtttggttgaatccgagttca |
38884221 |
T |
|
| Q |
122 |
aatcttgactgaaacaatcactggccataattttgttacccttggtcaaactctagattactagaatcccttcctgttagaactggcaggtgaagacaca |
221 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
38884220 |
aatcctgactgaaacaatcactggccataattttgttaccgttggtcaaactctagattactagaatcccttcccatgagaactggcaggtgaagacaca |
38884121 |
T |
|
| Q |
222 |
aaaagacatgaagagaaaatgatagtagtttg |
253 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |
|
|
| T |
38884120 |
aaaagacatgaagaaaaaatgatagtagtttg |
38884089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University