View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3857_low_52 (Length: 264)
Name: NF3857_low_52
Description: NF3857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3857_low_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 13 - 263
Target Start/End: Complemental strand, 41090024 - 41089774
Alignment:
| Q |
13 |
cagatttcaagcaagcaaaccttcagcctctttctactgagcaaccacgagctcctacctttcataatccaaagcctgcgcgcgctccgttttggaagaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41090024 |
cagatttcaagcaagcaaaccttcagcctctttctactgagcaaccacgagctcctacctttcataatccaaagcctgtgcgcgctccgttttggaagaa |
41089925 |
T |
|
| Q |
113 |
accggaaactccttttgttaaagcgaatagtaacacttgtttgcagctgcaaggttggtgaggtgttggagctaccgttcgagattctaatggtttagcc |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||| |||||||| |||||||||||||||||| |||||| |
|
|
| T |
41089924 |
accggaaactccttttgtcaaagcgaatagtaacacctgtttgcagctgcaaggttggtggggtattggagctgtcgttcgagattctaatggcttagcc |
41089825 |
T |
|
| Q |
213 |
atggcagcaacaacttggaagatccctggttcagatagtgttgaattagct |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41089824 |
atggcagcaacaacttggaagatccctggttcagatagtgttgaattagct |
41089774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University