View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3857_low_57 (Length: 250)
Name: NF3857_low_57
Description: NF3857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3857_low_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 38628594 - 38628475
Alignment:
| Q |
1 |
cagtgataggagcccagtcctacttctgatgggaggaggtatgggagctggcaagagcactgtactcaaggatattctcaaagagtaagcaattacagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38628594 |
cagtgataggagcccagtcctacttctgatgggaggaggtatgggagctggcaagagcactgtactcaaggatattctcaaagagtaagcaattacagtt |
38628495 |
T |
 |
| Q |
101 |
tctgaacaaaaattaaacat |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38628494 |
tctgaacaaaaattaaacat |
38628475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 149 - 244
Target Start/End: Complemental strand, 38628446 - 38628350
Alignment:
| Q |
149 |
agttctgtataaaataaagtctacgcataatggattgtttgagcatagattaatcttcaag-tattaagaaaaattgtgcaatagaattcatctcac |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
38628446 |
agttctgtataaaataaagtctacgcataatggattgtttgagcatagattaatcttcaagttattaagaaaaattgtgcaatagaattcatatcac |
38628350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 31168619 - 31168713
Alignment:
| Q |
1 |
cagtgataggagcccagtcctacttctgatgggaggaggtatgggagctggcaagagcactgtactcaaggatattctcaaagagtaagcaatta |
95 |
Q |
| |
|
||||||||||||||| || || ||| | ||||| || ||||||||||||||||||||||| || || || ||||||||||||||||||| ||||| |
|
|
| T |
31168619 |
cagtgataggagccctgtgctccttttcatgggcggtggtatgggagctggcaagagcacggtgcttaaagatattctcaaagagtaagaaatta |
31168713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University