View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3857_low_67 (Length: 237)
Name: NF3857_low_67
Description: NF3857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3857_low_67 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 33994551 - 33994418
Alignment:
| Q |
1 |
tttttatggttgtgatgacaagtaacataaggtgtttcacaattgtccattaaacattaaggtatatatgtggatgtaattaacggttgtaatgacaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33994551 |
tttttatggttgtgatgacaagtaacataaggtgtttcacaattgtccattaaacattaaggtatatatgtggatgtaattaacagttgtaatgacaagt |
33994452 |
T |
|
| Q |
101 |
aacgtaaggtgcattacaactatcagttaacaat |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
33994451 |
aacgtaaggtgcattacaactatcagttaacaat |
33994418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University