View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3857_low_70 (Length: 232)

Name: NF3857_low_70
Description: NF3857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3857_low_70
NF3857_low_70
[»] scaffold0168 (1 HSPs)
scaffold0168 (2-217)||(21400-21616)


Alignment Details
Target: scaffold0168 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: scaffold0168
Description:

Target: scaffold0168; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 2 - 217
Target Start/End: Original strand, 21400 - 21616
Alignment:
2 cttcataggttgtgtacagtggtggcnnnnnnnn-atataaattttacatggatagtatttattatgagtgatgaaattgtgagagagaacttgcaaaca 100  Q
    ||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21400 cttcataggttgtgtacagtggtggctttttttttatataaattttacatggatagtatttattatgagtgatgaaattgtgagagagaacttgcaaaca 21499  T
101 agatagaatgattcattgattttccttactttattgaataaagactacaaagtatgtatgtaagatgtaagttgcaccataagctaggctatgtctaaca 200  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||    
21500 agatagattgattcattgattttccttactttattgaataaagactacaaagtatgtatacaagatgtaagttgcaccataagctaggctatgtctaaca 21599  T
201 tagagtacaaatgttat 217  Q
    |||||||||| ||||||    
21600 tagagtacaactgttat 21616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University