View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3857_low_70 (Length: 232)
Name: NF3857_low_70
Description: NF3857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3857_low_70 |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0168 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 2 - 217
Target Start/End: Original strand, 21400 - 21616
Alignment:
| Q |
2 |
cttcataggttgtgtacagtggtggcnnnnnnnn-atataaattttacatggatagtatttattatgagtgatgaaattgtgagagagaacttgcaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21400 |
cttcataggttgtgtacagtggtggctttttttttatataaattttacatggatagtatttattatgagtgatgaaattgtgagagagaacttgcaaaca |
21499 |
T |
 |
| Q |
101 |
agatagaatgattcattgattttccttactttattgaataaagactacaaagtatgtatgtaagatgtaagttgcaccataagctaggctatgtctaaca |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21500 |
agatagattgattcattgattttccttactttattgaataaagactacaaagtatgtatacaagatgtaagttgcaccataagctaggctatgtctaaca |
21599 |
T |
 |
| Q |
201 |
tagagtacaaatgttat |
217 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
21600 |
tagagtacaactgttat |
21616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University