View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3857_low_77 (Length: 209)
Name: NF3857_low_77
Description: NF3857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3857_low_77 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 35 - 194
Target Start/End: Original strand, 15644290 - 15644449
Alignment:
| Q |
35 |
aacttataacatatatcttattgaagaaaatagggtaattttaacacaaatacacttcagatcgaatatggttatgatgttcaggtcgatcatagccaat |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15644290 |
aacttataacatatatcttattgaagaaaatagggtcattttaacacaaatacacttcagatcgaatatggttatgatgttcaggtcgatcatagccaat |
15644389 |
T |
 |
| Q |
135 |
tttatcaacgaaccataagacttccttgtcaagacggcaacctaaacatgtgtcgaaact |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15644390 |
gttatcaacgaaccataagacttccttgtcaagacggcaacctaaacatgtgtcgaaact |
15644449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 48
Target Start/End: Original strand, 15644148 - 15644176
Alignment:
| Q |
20 |
atgaaacccttcatcaacttataacatat |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15644148 |
atgaaacccttcatcaacttataacatat |
15644176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University