View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3858_low_19 (Length: 249)
Name: NF3858_low_19
Description: NF3858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3858_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 16 - 245
Target Start/End: Complemental strand, 3853307 - 3853078
Alignment:
| Q |
16 |
gtggtgggattcttgtgagctgctactctttttagtttccaaattcctctaaacatattctatcacaataaaaagcctttctagttttctacctttttct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3853307 |
gtggtgggattcttgtgagctgctactctttttagtttccaaattcctctaaacatattctatcacaataaaaagcctttctagttttctacctttttct |
3853208 |
T |
|
| Q |
116 |
ctctatgcaatgccaaatggagagatacaaatgcaagcttttctcacgaacattcatcaatggtaaagcattgggtggacatatggaagctcattttgcc |
215 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
3853207 |
ctctatgcaatgccaaatggagaggtacaaatgcaagctttgctcaagaacattcatcaatggtaaagcattgggtggacacatgaaagctcattttgcc |
3853108 |
T |
|
| Q |
216 |
accctccgtctttctcttacaaacccccaa |
245 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |
|
|
| T |
3853107 |
accctccgtctttctcttccaaacccccaa |
3853078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University