View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3860_high_12 (Length: 253)
Name: NF3860_high_12
Description: NF3860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3860_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 10 - 224
Target Start/End: Complemental strand, 46513139 - 46512925
Alignment:
| Q |
10 |
caatgagttgctttgttgtgtcgttctctgattataaagtatctgattttgtttaactaatactccttttatcctcaactatgtcactctaacacataac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
46513139 |
caatgagttgctttgttgtgtcgttctctgattataaagtatctgattttgtttaactaatactccttttatcctcaaatatgtcactctgacacataac |
46513040 |
T |
 |
| Q |
110 |
gtccgagttaacaaaacatagcgaattttgtatgcgcaagactgctcctaataacaccattttttaaacttgtgccctatgaatcccggatacgtagtat |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46513039 |
gtccgagttaacaaaacatagctaattttgtatgcgcaagactgctcttaataacaccattttttaaacttgtgccctatgaatcccggatacgtagtat |
46512940 |
T |
 |
| Q |
210 |
gggtgcgggcacaat |
224 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46512939 |
gggtgcgggcacaat |
46512925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University