View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3860_high_8 (Length: 322)
Name: NF3860_high_8
Description: NF3860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3860_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 573179 - 572957
Alignment:
| Q |
1 |
atccaattctccatcgattgttcataattataatacacttgcataatacacggtgtagcactaacattgtttagtgtctcaaaatattattagtgtcaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
573179 |
atccaattctccatcgattgttcataattttaatacacttgcataatacacggtgtagcactaacattgtttagtgtcccaaaatattattagtgtcaac |
573080 |
T |
|
| Q |
101 |
atgtctgcctgaatatcatgtccaatgtttgtgtcgggtgctgcttattcgtactttttgtgatgatacaaacatggagtaaattggtttatgttgtttt |
200 |
Q |
| |
|
||||||| ||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
573079 |
atgtctgtctgaatatcatgttcaatgtttatgttgggtgctgcttattcgtactttttgtgatgatacaaacatagagtaaattggtttatgttgtttt |
572980 |
T |
|
| Q |
201 |
aagtgcatgtttggttacttaag |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
572979 |
aagtgcatgtttggttacttaag |
572957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University