View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3860_low_16 (Length: 229)
Name: NF3860_low_16
Description: NF3860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3860_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 19 - 164
Target Start/End: Complemental strand, 573390 - 573244
Alignment:
| Q |
19 |
gtttttggttcattgcttggaaagtagaattttgcttcggtgttgctttatgaaaatttacaaccatggggttgcttctctc-tttatgttccaagtctt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
573390 |
gtttttggttcattgcttggaaagtagaattttgcttcggtgttgttttatgaaaatttacaaccatggggttgcttctttcttttatgttccaagtctt |
573291 |
T |
|
| Q |
118 |
tagtttttgtatgtttaaatatgaaatttctttcatgggttgtctca |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
573290 |
tagtttttgtatgtttaaatatgaaatttctttcatgggttgtctca |
573244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University