View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3860_low_16 (Length: 229)

Name: NF3860_low_16
Description: NF3860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3860_low_16
NF3860_low_16
[»] chr8 (1 HSPs)
chr8 (19-164)||(573244-573390)


Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 19 - 164
Target Start/End: Complemental strand, 573390 - 573244
Alignment:
19 gtttttggttcattgcttggaaagtagaattttgcttcggtgttgctttatgaaaatttacaaccatggggttgcttctctc-tttatgttccaagtctt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |||||||||||||||||    
573390 gtttttggttcattgcttggaaagtagaattttgcttcggtgttgttttatgaaaatttacaaccatggggttgcttctttcttttatgttccaagtctt 573291  T
118 tagtttttgtatgtttaaatatgaaatttctttcatgggttgtctca 164  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
573290 tagtttttgtatgtttaaatatgaaatttctttcatgggttgtctca 573244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University