View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3860_low_17 (Length: 216)

Name: NF3860_low_17
Description: NF3860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3860_low_17
NF3860_low_17
[»] chr6 (2 HSPs)
chr6 (1-62)||(2954002-2954061)
chr6 (128-179)||(2953885-2953936)


Alignment Details
Target: chr6 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 2954061 - 2954002
Alignment:
1 gcctgttgtcatgtagtgttttagttttttaactaattcaatttaaaatcttagttatgaaa 62  Q
    ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
2954061 gcctgttgtcatgtagtgttttagtttt--aactaattcaatttaaaatcttagttatgaaa 2954002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 128 - 179
Target Start/End: Complemental strand, 2953936 - 2953885
Alignment:
128 catagttaaaattcagaatcgtttgttgccaatttatttataatttgacata 179  Q
    |||||||| |||||||||||||||||||||| ||||||||||||||||||||    
2953936 catagttataattcagaatcgtttgttgccattttatttataatttgacata 2953885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University