View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3860_low_17 (Length: 216)
Name: NF3860_low_17
Description: NF3860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3860_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 2954061 - 2954002
Alignment:
| Q |
1 |
gcctgttgtcatgtagtgttttagttttttaactaattcaatttaaaatcttagttatgaaa |
62 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2954061 |
gcctgttgtcatgtagtgttttagtttt--aactaattcaatttaaaatcttagttatgaaa |
2954002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 128 - 179
Target Start/End: Complemental strand, 2953936 - 2953885
Alignment:
| Q |
128 |
catagttaaaattcagaatcgtttgttgccaatttatttataatttgacata |
179 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2953936 |
catagttataattcagaatcgtttgttgccattttatttataatttgacata |
2953885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University