View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3863_high_18 (Length: 399)
Name: NF3863_high_18
Description: NF3863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3863_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 11 - 382
Target Start/End: Original strand, 5957666 - 5958037
Alignment:
| Q |
11 |
ggaggagcacagagggagtttctacctacggtgcgtgtgcacgagtttccaatggacccagatatatacaccgaatggaagatgttacaatggaagccgc |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5957666 |
ggagcagcacagagggagtttctacctacggtgcgtgtgcaggagtttccaatggacccagatatatacacagaatggaagatgttacaatggaagccgc |
5957765 |
T |
|
| Q |
111 |
cggagtttgcgcgagcacctggtgggccaccgtcgaatgtggcggtggcccatgtcaggcttggcggacgggcggctttgttggggaaagttggggagga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5957766 |
cggagtttgcgcgagcacctggtgggccgccgtcgaatgtggcggtggcccatgtcaggcttggcggacgggcggctttgttggggaaagttggggagga |
5957865 |
T |
|
| Q |
211 |
tgagtttggggaggagattgttttggggatgaataaggagaaggtgcagactagaggggtgaagtttgattcggggtttcggactgggtgtagttatatg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5957866 |
tgagtttggggaggagattgttttggggatgaataaggagaaggtgcagactagaggggtgaagtttgattcggggtttcggactgggtgtagttatatg |
5957965 |
T |
|
| Q |
311 |
aaggtgaagtttgatgatgatgggaagatggggatggagattgttaaggaatgtgctgaggattctcttagg |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5957966 |
aaggtgaagtttgatgatgatgggaagatggggatggagattgttaaggaatgtgctgaggattctcttagg |
5958037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University