View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3863_high_28 (Length: 346)
Name: NF3863_high_28
Description: NF3863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3863_high_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 20 - 333
Target Start/End: Original strand, 42798788 - 42799100
Alignment:
| Q |
20 |
ccttctaccatcaattcatcttaagagcaggtgctgttaaagctcttggatcattcaggagtaaccctactgtttaagtgcactgttcttcctcttcatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42798788 |
ccttctaccatcaattcatcttaagagcaggtgctgttaaagctcttggatcattcaggagtaaccctactgtttaagtgcactgttcttcctcttcatc |
42798887 |
T |
|
| Q |
120 |
atggttttaatggaaaagaagataattgaagagatggattaattgatgatatttgttttgtatttgcaacacctcttcaattgtgtcttcaagattgtgg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42798888 |
atggttttaatggaaaagaagataattgaagagatggattaattgatgatatttgttttgtatttgcaacacctcttcaattgtgtcttcaagattgtgg |
42798987 |
T |
|
| Q |
220 |
ataagtgtaaattaaaagtctctttcgttacagggggagcctttttacactttcctctgtattctctttagtgtgtcatcttttcttttttaagttattc |
319 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42798988 |
ataagtgtaaatt-aaagtctctttcgttacagggggagcctttttacactttcctctgtattctctttagtgtgtcatcttttcttttttaagttattc |
42799086 |
T |
|
| Q |
320 |
tcttctgtgctcct |
333 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
42799087 |
tcttctgtgatcct |
42799100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University