View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3863_high_47 (Length: 251)
Name: NF3863_high_47
Description: NF3863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3863_high_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 56 - 174
Target Start/End: Original strand, 28094551 - 28094669
Alignment:
| Q |
56 |
cattgaactcttctcacatcactttctaattaaaccattttaatattaatagcaaataccggcaacattgaatctacatgttcggtttctgtaatgcaat |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28094551 |
cattgaactcttctcacatcactttctaattaaaccattttaatattaatagcaaatactggcaacattgaatctacatgttcggtttctgtaatgcaat |
28094650 |
T |
 |
| Q |
156 |
tcaatggagtttctttcca |
174 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
28094651 |
tcaatggagtttctttcca |
28094669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University