View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3863_high_50 (Length: 250)
Name: NF3863_high_50
Description: NF3863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3863_high_50 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 31 - 240
Target Start/End: Complemental strand, 21543414 - 21543205
Alignment:
| Q |
31 |
tcacattacttgagcatgcaggtatgggaatcagtagagcaacttgaggcactcatcatttagcaagactatttgtgtgtcttttaccggggaataagaa |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21543414 |
tcacattacttgagcatgcaggtatgggaatcagtagagcaacttgaggcactcatcatttagcaagactatttgtgtgtcttttaccagggaataagaa |
21543315 |
T |
 |
| Q |
131 |
caacaaaatatttattcagagtaagtattctagagaacgaaggaaaatgaattttgagagtataatagtttacttcaaggagatgagactttgaaaatag |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21543314 |
caacaaaatatttattcagagtaagtattctagagaacgaaggaaaatgaattttgagagtataatagtttacttcaaggagatgagactttgaaaatag |
21543215 |
T |
 |
| Q |
231 |
aagagtataa |
240 |
Q |
| |
|
|||||||||| |
|
|
| T |
21543214 |
aagagtataa |
21543205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University