View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3863_high_54 (Length: 238)
Name: NF3863_high_54
Description: NF3863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3863_high_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 73 - 221
Target Start/End: Original strand, 38664628 - 38664774
Alignment:
| Q |
73 |
tccgcccgtgtggacatcaacaaagtaacaattgtcttccaatttccttnnnnnnnnnnnnnntttgtcttccaatcattcatgataagttaataaatgg |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38664628 |
tccgcccgtgtggacatcaacaaagtaacaattgtcttccaatttccttcaaaaaaaaaaaa--ttgtcttccaattattcatgataagttaataaatgg |
38664725 |
T |
|
| Q |
173 |
ttaatgacggctaactttcagttaccaaattcatacacaatccaaaatt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38664726 |
ttaatgacggctaactttcagttaccaaattcatacacaatccaaaatt |
38664774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University