View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3863_high_57 (Length: 237)
Name: NF3863_high_57
Description: NF3863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3863_high_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 104 - 221
Target Start/End: Original strand, 26174701 - 26174818
Alignment:
| Q |
104 |
aacatttgtgaaatgccgatgctcaaatttgcaaaatgctatagaatacatttatctattcacagctcacacatgtgatctcagttccctatttgttatg |
203 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26174701 |
aacatttgtaaaatgccgatgctcaaatttgcaaaatgctatagaatacatttatctattcacagctcacacatgtgatctcagttccctatttgttctg |
26174800 |
T |
|
| Q |
204 |
tactatgatagatattag |
221 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
26174801 |
tactatgatagatattag |
26174818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 121 - 221
Target Start/End: Complemental strand, 26130943 - 26130843
Alignment:
| Q |
121 |
gatgctcaaattt-gcaaaatgctatagaatacatttatctattcacagctcacacatgtgatctcagttccctatttgttatgtac-tatgatagatat |
218 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||| ||||| |||||||||||||||||| |||||||||| | ||||| |||||||||| | |
|
|
| T |
26130943 |
gatgctcaaattttgcaaaatgcta--gaatacatttatctggtcacaactcacacatgtgatctcaactccctatttgctttgtacttatgatagattt |
26130846 |
T |
|
| Q |
219 |
tag |
221 |
Q |
| |
|
||| |
|
|
| T |
26130845 |
tag |
26130843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 61 - 110
Target Start/End: Original strand, 1463504 - 1463553
Alignment:
| Q |
61 |
attatgtaagcaagtacaacaaattggccactttttgatagagaacattt |
110 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||| ||| |||||||||| |
|
|
| T |
1463504 |
attatgtaagcaaatacaacaaattggtcacttttggatggagaacattt |
1463553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University