View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3863_low_35 (Length: 316)
Name: NF3863_low_35
Description: NF3863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3863_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 296
Target Start/End: Original strand, 28965602 - 28965897
Alignment:
| Q |
1 |
aacactgttgcattgccaatgaatctaacatttgaggtcagatcaagggcttacattttgggaagattggttaagtctactttctatcataggatcagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28965602 |
aacactgttgcattgccaatgaatctaacatttgaggtcagatcaagggcttacattttgggaagattggttaagtctactttctatcataggatcagat |
28965701 |
T |
 |
| Q |
101 |
gttcaatcacttttcatggcaacaaacttggaaatcatcttgatttcacggattcgtgtgtctacaagtaatttattgatgttctttgggtggatctcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28965702 |
gttcaatcacttttcatggcaacaaacttggaaatcatcttgatttcacggattcgtgtgtctacaagtaatttattgatgttctttgggtggatctcta |
28965801 |
T |
 |
| Q |
201 |
cctctcatttgtacacagcacgtaannnnnnngcttgacattaatttctatgtacgtttctattggattatgcttactgataataccactcctttg |
296 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28965802 |
cctctcatttgtacacagcacgtaatttttttgcttgacattaatttctatgtacgtttctattgcattatgcttactgataataccactcctttg |
28965897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 98 - 176
Target Start/End: Complemental strand, 35945637 - 35945559
Alignment:
| Q |
98 |
gatgttcaatcacttttcatggcaacaaacttggaaatcatcttgatttcacggattcgtgtgtctacaagtaatttat |
176 |
Q |
| |
|
||||| |||||||||| |||| |||| |||||||||| | |||| ||| | ||||| |||||||||||||||||||| |
|
|
| T |
35945637 |
gatgtccaatcactttccatgtcaaccaacttggaaaacctcttagtttgatagattcatgtgtctacaagtaatttat |
35945559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University