View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3863_low_43 (Length: 271)
Name: NF3863_low_43
Description: NF3863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3863_low_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 109 - 258
Target Start/End: Original strand, 23087136 - 23087288
Alignment:
| Q |
109 |
tgttttgttgtttaattgtaagttttatgttttgctgttttacttctagactaatggatatttcttgaattacagatctgcaaatctgactccaagcaca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23087136 |
tgttttgttgtttaattgtaagttttatgttttgctgtattacttctagactaatggatatttcttgaattacagatctgcaaatctgactccaagcaca |
23087235 |
T |
|
| Q |
209 |
tactccgtacacgcaagtatg---gtatatgatgataatgaaattggagatat |
258 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
23087236 |
tactccgtacacgcaagtatggtagtagatgatgataatgaaattggagatat |
23087288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 22 - 58
Target Start/End: Original strand, 23087088 - 23087124
Alignment:
| Q |
22 |
aagttctcttataccatttacaagttttaaagtttac |
58 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
23087088 |
aagttctcttattccatttacaagttttaaaatttac |
23087124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 144 - 209
Target Start/End: Original strand, 24022785 - 24022849
Alignment:
| Q |
144 |
tgttttacttctagactaatggatatttcttgaattacagatctgcaaatctgactccaagcacat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| || ||||||| | ||||||||||||| |
|
|
| T |
24022785 |
tgttttacttctagactaatggatattt-ttgaattataggtctgcaagaccaactccaagcacat |
24022849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 180
Target Start/End: Complemental strand, 11338281 - 11338232
Alignment:
| Q |
130 |
gttttatgttttgctgttttacttctagactaatggatatttcttgaatta |
180 |
Q |
| |
|
||||||||||||| |||||||||||||| || |||||||||| |||||||| |
|
|
| T |
11338281 |
gttttatgttttgttgttttacttctagtcttatggatattt-ttgaatta |
11338232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 130 - 190
Target Start/End: Complemental strand, 11356844 - 11356785
Alignment:
| Q |
130 |
gttttatgttttgctgttttacttctagactaatggatatttcttgaattacagatctgca |
190 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||| ||||||| |||||||| || |||||| |
|
|
| T |
11356844 |
gttttatgttttgttgttttacttctaacctaattgatattt-ttgaattataggtctgca |
11356785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University