View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3863_low_45 (Length: 265)
Name: NF3863_low_45
Description: NF3863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3863_low_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 4 - 129
Target Start/End: Complemental strand, 28584765 - 28584640
Alignment:
| Q |
4 |
ctctgttcttgttgaggtttactccaagaatgtggctagttttgtgaacaatggattttgtgccattgcgactctcttgtctctccttattgaagtggtt |
103 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28584765 |
ctctgttcttgttgaggtttactccaaaaatgtggctagttttgtgaacaatggattttgtgccattgcgactctcttgtctctccttattgaagtggtt |
28584666 |
T |
 |
| Q |
104 |
catctgcttcctgctatggagcacat |
129 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
28584665 |
catctgcttcctgctatggagcacat |
28584640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 3 - 150
Target Start/End: Original strand, 28418484 - 28418632
Alignment:
| Q |
3 |
cctctgttcttgttgaggttt-actccaagaatgtggctagttttgtgaacaatggattttgtgccattgcgactctcttgtctctccttattgaagtgg |
101 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||| || ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28418484 |
cctctgttcttgttgaggttttactccacgaatgtggctagttttgtgaacaatgaatcttgtgccattgcgactctcgggtctctccttattgaagtgg |
28418583 |
T |
 |
| Q |
102 |
ttcatctgcttcctgctatggagcacatgcctctctttctcacattttc |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28418584 |
ttcatctgcttcctgctatggagcacatgcctctctttctcacattttc |
28418632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University