View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3863_low_50 (Length: 251)

Name: NF3863_low_50
Description: NF3863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3863_low_50
NF3863_low_50
[»] chr5 (1 HSPs)
chr5 (56-174)||(28094551-28094669)


Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 56 - 174
Target Start/End: Original strand, 28094551 - 28094669
Alignment:
56 cattgaactcttctcacatcactttctaattaaaccattttaatattaatagcaaataccggcaacattgaatctacatgttcggtttctgtaatgcaat 155  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
28094551 cattgaactcttctcacatcactttctaattaaaccattttaatattaatagcaaatactggcaacattgaatctacatgttcggtttctgtaatgcaat 28094650  T
156 tcaatggagtttctttcca 174  Q
    |||||||||||||||||||    
28094651 tcaatggagtttctttcca 28094669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University