View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3863_low_55 (Length: 241)
Name: NF3863_low_55
Description: NF3863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3863_low_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 8 - 224
Target Start/End: Original strand, 1073747 - 1073963
Alignment:
| Q |
8 |
gaagcaaaggcaaaagtgaagagcggcgatggtggatttagatcaaggttgaatcaaattctgtatagcggtgaaaagaagcatgttttcgctggcttag |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1073747 |
gaagcaaaagcaaaagtgaagagcggcgatggtggatttagatcaaggttgaatcaaattctgtatagcggtgaaaagaagcatgttttcgctggcttag |
1073846 |
T |
 |
| Q |
108 |
ttctcatcactgccgttttttctgtaccatggtttcttatgaacagaggtttgttcctttcaaatttcaacttttttgttattgtcaannnnnnnaaatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1073847 |
ttctcatcactgccgttttttctgtaccatggtttcttatgaacagaggttcgttcctttcaaatttcaacttttttgttattgtcaatttttttaaatt |
1073946 |
T |
 |
| Q |
208 |
ggtttcaaagttcttat |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1073947 |
ggtttcaaagttcttat |
1073963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University