View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3863_low_60 (Length: 237)

Name: NF3863_low_60
Description: NF3863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3863_low_60
NF3863_low_60
[»] chr3 (1 HSPs)
chr3 (104-221)||(26174701-26174818)
[»] chr7 (1 HSPs)
chr7 (121-221)||(26130843-26130943)
[»] chr8 (1 HSPs)
chr8 (61-110)||(1463504-1463553)


Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 104 - 221
Target Start/End: Original strand, 26174701 - 26174818
Alignment:
104 aacatttgtgaaatgccgatgctcaaatttgcaaaatgctatagaatacatttatctattcacagctcacacatgtgatctcagttccctatttgttatg 203  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
26174701 aacatttgtaaaatgccgatgctcaaatttgcaaaatgctatagaatacatttatctattcacagctcacacatgtgatctcagttccctatttgttctg 26174800  T
204 tactatgatagatattag 221  Q
    ||||||||||||||||||    
26174801 tactatgatagatattag 26174818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 121 - 221
Target Start/End: Complemental strand, 26130943 - 26130843
Alignment:
121 gatgctcaaattt-gcaaaatgctatagaatacatttatctattcacagctcacacatgtgatctcagttccctatttgttatgtac-tatgatagatat 218  Q
    ||||||||||||| |||||||||||  ||||||||||||||  ||||| ||||||||||||||||||  |||||||||| | ||||| |||||||||| |    
26130943 gatgctcaaattttgcaaaatgcta--gaatacatttatctggtcacaactcacacatgtgatctcaactccctatttgctttgtacttatgatagattt 26130846  T
219 tag 221  Q
    |||    
26130845 tag 26130843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 61 - 110
Target Start/End: Original strand, 1463504 - 1463553
Alignment:
61 attatgtaagcaagtacaacaaattggccactttttgatagagaacattt 110  Q
    ||||||||||||| ||||||||||||| ||||||| ||| ||||||||||    
1463504 attatgtaagcaaatacaacaaattggtcacttttggatggagaacattt 1463553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University