View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3864_high_11 (Length: 249)
Name: NF3864_high_11
Description: NF3864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3864_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 3 - 233
Target Start/End: Complemental strand, 2590633 - 2590397
Alignment:
| Q |
3 |
caaaggcctctcttaaccttctgttgattacagcatgaatggtgacccatctttctcttgttctattcctgtctctttttgtttagtaaattgtaccttc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2590633 |
caaaggcctctcttaaccttctgttgattacagcatgaatggtgacccatctttctcttgttctatgcctgtctctttttgtttagtaaattgtaccttc |
2590534 |
T |
|
| Q |
103 |
attcatatatcagtgtatgtgtgcaagtgcaagt------gcaatgcaatagttatctctttctctttctatctttccttcttttaaaactgagggaact |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2590533 |
attcatatatcagtgtatgtgtgcaagtgcaagtgcaagtgcaatgcaatagttatctctttctctttctatctttccttcttttaaaactgagggaact |
2590434 |
T |
|
| Q |
197 |
gaagtcgacatttacaacctgcatgtaggacccatat |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2590433 |
gaagtcgacatttacaacctgcatgtaggacccatat |
2590397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 3 - 52
Target Start/End: Original strand, 41351605 - 41351654
Alignment:
| Q |
3 |
caaaggcctctcttaaccttctgttgattacagcatgaatggtgacccat |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||| ||||| |||||||| |
|
|
| T |
41351605 |
caaagacctctcttaaccttctgttgattgcagcaagaatgctgacccat |
41351654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University