View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3864_low_11 (Length: 273)
Name: NF3864_low_11
Description: NF3864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3864_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 8795790 - 8796023
Alignment:
| Q |
1 |
tattatatagttgaaaatttgactttctaatttatataatgtgtannnnnnnn-----agtttcttgtatattctctttattggaggtaattctatttgt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8795790 |
tattatatagttgaaaatttgactttctaatttatataatgtgtatttttttttttttagttttttgtatattctctttattggaggtaattttatttgt |
8795889 |
T |
 |
| Q |
96 |
gaagatgaattttgattcgtcacattagagaaaactaatannnnnnnn-ggatctaatcccaactgatata--tatgtgtatttaattacatacaatgaa |
192 |
Q |
| |
|
|| |||| ||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
8795890 |
gatgatggattttgatttgtcacattagagaaaactaatacctttttttggatctaatcccaactgatatagatatgtgtatttaatcacatacaatgaa |
8795989 |
T |
 |
| Q |
193 |
aattatcaaatttttaaataaatttcaatatctt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8795990 |
aattatcaaatttttaaataaatttcaatatctt |
8796023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University