View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3864_low_5 (Length: 447)
Name: NF3864_low_5
Description: NF3864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3864_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-165; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 128 - 438
Target Start/End: Original strand, 8795485 - 8795795
Alignment:
| Q |
128 |
caacaaggggtggtgggtgaaagttaggattgaggaataattattgatgtgaatagagtagtcttgtccaacattgatttgcttagcttaggtgtgtgga |
227 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8795485 |
caacaaggggaggtgggtgaaagttaggattgaggaataattattgatgtgaatagagtagtcttgtccaacattgatttgcttagcttaggtgtgtgga |
8795584 |
T |
 |
| Q |
228 |
tgatattgaagcatagcatagagaaggaatacaaaaattaggtatatatggtaagtgtgactctgcatgatgtgggcagggcagggtagaacgccgacca |
327 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8795585 |
tgatattgaaccatagcatagagaaggaatgcaaaaattaggtatatatggtaagtgtgactctgcatgatgtgggcagggcagggtagaacgccgacca |
8795684 |
T |
 |
| Q |
328 |
cctgatgatctaactttattccaattttatgccatgaaagctcaatgcatgattcacatgacctttgaaaattaggtatgtcacttgcatgtaatgtctc |
427 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8795685 |
cctgatgatctaactttattccaattttatgccatgaaagctcaatgcatgattcacatgacctttgaaaattaggtatgtcacttgcatgtaaagtctc |
8795784 |
T |
 |
| Q |
428 |
tcaagtattat |
438 |
Q |
| |
|
||||||||||| |
|
|
| T |
8795785 |
tcaagtattat |
8795795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 20 - 96
Target Start/End: Original strand, 8795377 - 8795453
Alignment:
| Q |
20 |
acgtttgtgtcacccaccaagaacaaacttctcataaaaggggttgtgttgtgtatagtagtagatttaattcattg |
96 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8795377 |
acgtttgtgtcacccaccaagaacaaaattctcataaagggggttgtgttgtgtatagtagtagatttaattcattg |
8795453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University