View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3865_high_10 (Length: 238)

Name: NF3865_high_10
Description: NF3865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3865_high_10
NF3865_high_10
[»] chr1 (1 HSPs)
chr1 (18-238)||(43450169-43450389)


Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 43450389 - 43450169
Alignment:
18 tatgcctgtaggcacttgaggcttccatgtcattttttatgaatatttagtttaccagaatttgatgtttgatttggttttcaacttgtgacagccaaat 117  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
43450389 tatgcctgtaggcacatgaggcttccatgtcattttttatgaatatttagtttaccagaatttgatgcttgatttggttttcaacttgtgacagccaaat 43450290  T
118 acacgcatccggataaatagcattatgggctatgaggactacccaaaagttactatggacgatataaatttggaatcatcatgaacattttgtgcgctat 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
43450289 acacgcatccggataaatagcattatgggctatgaggactacccaaaagttaccatggacgatataaatttggaatcatcatgaacattttgtgcgctat 43450190  T
218 gcgagtattgtatcttctttc 238  Q
    |||||||||||||||||||||    
43450189 gcgagtattgtatcttctttc 43450169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University