View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3865_high_8 (Length: 278)
Name: NF3865_high_8
Description: NF3865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3865_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 101 - 262
Target Start/End: Original strand, 35234994 - 35235155
Alignment:
| Q |
101 |
ccacaacccacaaactcacattccctcttactaaaaccccattttctctctccacaatttccttcaccgtcaaagcaattcccacctccgatgaattcga |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35234994 |
ccacaacccacaaactcacattcccacttactaaaaccccattcactctctccacaatttccttcaccgtcaaagcaattcccacctccgatgaattcga |
35235093 |
T |
 |
| Q |
201 |
catcaccatcccagaagaagaccttcccttcaacccaccggaaatcccggaaggcttcattc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35235094 |
catcaccatcccagaagaagaccttcccttcaacccaccggaaatcccggaaggcttcattc |
35235155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University