View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3865_low_11 (Length: 238)
Name: NF3865_low_11
Description: NF3865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3865_low_11 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 43450389 - 43450169
Alignment:
| Q |
18 |
tatgcctgtaggcacttgaggcttccatgtcattttttatgaatatttagtttaccagaatttgatgtttgatttggttttcaacttgtgacagccaaat |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43450389 |
tatgcctgtaggcacatgaggcttccatgtcattttttatgaatatttagtttaccagaatttgatgcttgatttggttttcaacttgtgacagccaaat |
43450290 |
T |
|
| Q |
118 |
acacgcatccggataaatagcattatgggctatgaggactacccaaaagttactatggacgatataaatttggaatcatcatgaacattttgtgcgctat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43450289 |
acacgcatccggataaatagcattatgggctatgaggactacccaaaagttaccatggacgatataaatttggaatcatcatgaacattttgtgcgctat |
43450190 |
T |
|
| Q |
218 |
gcgagtattgtatcttctttc |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43450189 |
gcgagtattgtatcttctttc |
43450169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University