View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3865_low_8 (Length: 278)

Name: NF3865_low_8
Description: NF3865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3865_low_8
NF3865_low_8
[»] chr4 (1 HSPs)
chr4 (101-262)||(35234994-35235155)


Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 101 - 262
Target Start/End: Original strand, 35234994 - 35235155
Alignment:
101 ccacaacccacaaactcacattccctcttactaaaaccccattttctctctccacaatttccttcaccgtcaaagcaattcccacctccgatgaattcga 200  Q
    ||||||||||||||||||||||||| |||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35234994 ccacaacccacaaactcacattcccacttactaaaaccccattcactctctccacaatttccttcaccgtcaaagcaattcccacctccgatgaattcga 35235093  T
201 catcaccatcccagaagaagaccttcccttcaacccaccggaaatcccggaaggcttcattc 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35235094 catcaccatcccagaagaagaccttcccttcaacccaccggaaatcccggaaggcttcattc 35235155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University