View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3866_high_7 (Length: 374)
Name: NF3866_high_7
Description: NF3866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3866_high_7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 23 - 374
Target Start/End: Original strand, 52379385 - 52379735
Alignment:
| Q |
23 |
tcatatatgttgtagcaactacaaaatattagcacttgtcatgaaaacttaaccaacattatgcactgcatggattttttaagatgatggctttagaatg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||||| |||| |
|
|
| T |
52379385 |
tcatatatgttgtagcaactacaaaatattagcacttgtcatgaaaacttaaccaacattatgtactgcatggatttt-taagatgatagctttacaatg |
52379483 |
T |
 |
| Q |
123 |
aaattgattgcataattacctttgctcattgccaaattgccttccattggtgatattgataccagcacctcccctgtatgttggcagtgggatttgatca |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52379484 |
aaattgattgcataattacctttgctcattgccaaattgccttccattggtgatattgataccagcacctcccctgtatgttggcagtgggatttgatca |
52379583 |
T |
 |
| Q |
223 |
tgctcaattcgtatgagatcttccttgaggatctcgtaatgcattttcacctcttgtatggattttccaccaacagcattagctacatgttgccaccgat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52379584 |
tgctcaattcgtatgagatcttccttgaggatctcgtaatgcattttcacctcttgtatggattttccaccaacagcattagctacatgttgccaccgat |
52379683 |
T |
 |
| Q |
323 |
ttggatcttctggaccatatactgcaagtgcatcctcaaaacgtctgttctc |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52379684 |
ttggatcttctggaccatatactgcaagtgcatcctcaaaacgtctgttctc |
52379735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University