View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3867_high_14 (Length: 312)
Name: NF3867_high_14
Description: NF3867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3867_high_14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 13 - 312
Target Start/End: Original strand, 53128163 - 53128462
Alignment:
| Q |
13 |
cagatgcgtaagataggtgacaaatttctatttcatagatgttatgacttacaaatgatacgatacatcaactaatggggtctccaaatgagtggcgacc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53128163 |
cagatgcgtaagataggtgacaaatttctatttcatagatgttatgacttacaaatgatatgatacatcaactaatggggtctccaaatgagtggcgacc |
53128262 |
T |
 |
| Q |
113 |
acatagacctgaagctggagattttggaagccaaaaccaaaagcaacaccaccagcgccgcgacgccccaaggtgacgatcctcctccttctgtttgtgt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53128263 |
acatagacctgaagctggagattttggaagccaaaaccaaaagcaacaccaccagcgccgcaacgccccaaggtgacgatcctcctccttctgtttgtgc |
53128362 |
T |
 |
| Q |
213 |
gcgtgattgtattaaccgtcgaccaaagaaatccacctgaattacaaaccgtggcccgcatttggagatgaagtatgcaataaaaatcaacaggagtggc |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53128363 |
gcgtgattgtattaaccgtcgaccaaagaaatccaccggaattacaaaccgtggcccgcatttggagatgaagtatgcaataaaaatcaacaggagtggc |
53128462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University