View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3867_low_17 (Length: 285)
Name: NF3867_low_17
Description: NF3867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3867_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 19 - 271
Target Start/End: Original strand, 25194579 - 25194831
Alignment:
| Q |
19 |
cgtagaagggtgcctgacgcgttttgagtagagaatgaggtgtcttccttgatatcctagccttatataccggttttatgtacatttttcaagtgagagt |
118 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25194579 |
cgtagaagggtgcttgacgcgttttgagtagagaatgaggtgccttccttgatatcctagccttatataccggttttatgtacatttttcaagtgagagt |
25194678 |
T |
|
| Q |
119 |
ttgagatacttgtatgagaccaaaggagaaaatttttagaaaacttaaatgctaagagttaggtgttttgggcgagattattgagtttggaaacattcta |
218 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25194679 |
gtaagatacttgtatgagaccaaaggagaaaatttttagaaaacttaaatgctaagagttaggtgttttgggtgagattattgagtttggaaacattcta |
25194778 |
T |
|
| Q |
219 |
aataacttggatagtgatatctaattggaggaaagacctaagatttatgtctt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25194779 |
aataacttggatagtgatatctaattggaggaaagacctaagatttatgtctt |
25194831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University