View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3867_low_20 (Length: 259)
Name: NF3867_low_20
Description: NF3867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3867_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 41685680 - 41685428
Alignment:
| Q |
1 |
atagaaatagaaagagggagaaaaatggtaaacgttatgagacagtacctggtacatagatgcaaaacagtacagtacagaaatggtgttattgttagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41685680 |
atagaaatagaaagagggagaaaaatggtaaacgttatgagacagtacctggtacatagatgcaaaacagtacagtacagaaatggtgttattgttagga |
41685581 |
T |
|
| Q |
101 |
actca--cacatgacttaagggaatcatgcagtaacttt---agaagctgtcattaaactatttcaagaaagatttgataatacaataaataatgacatt |
195 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41685580 |
actcacacacatgacttaagggaatcatgcagtaactttagcagaagctgtcattaaactatttcaagaaagatttgataatacaataaataatgacatc |
41685481 |
T |
|
| Q |
196 |
cataaaatcataattttctgtttattacatgaagttcataattgctctccttt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41685480 |
cataaaatcataattttctgtttattacatgaagctcataattgctctccttt |
41685428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University