View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3870_high_12 (Length: 251)
Name: NF3870_high_12
Description: NF3870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3870_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 38 - 227
Target Start/End: Original strand, 3092623 - 3092812
Alignment:
| Q |
38 |
aaggaattctggtattacttgattctttctcttaacccacaacgtgatttaggtcatgataatcttaataaatggaataaattaagagtaaaatcatttt |
137 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3092623 |
aaggaattctggtatcacttgattctttatcttaacccaaaacgtgatttaggtcatgataatcttaataaatggaataaattaagagtaaagtcatttt |
3092722 |
T |
 |
| Q |
138 |
agctcaacgtacaatatatattttgtgtcaatcagataatctttggtgaatgcaaatgttgataaaatcaattaaagtacaaaattgtat |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3092723 |
agctcaacgtacaatatatattttgtgtcaaacatataatctttggtgaatgcaaatgttgataaaatcaattaaagtacaaaattgtat |
3092812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University