View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3870_low_16 (Length: 207)
Name: NF3870_low_16
Description: NF3870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3870_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 17 - 189
Target Start/End: Original strand, 51990685 - 51990857
Alignment:
| Q |
17 |
caaagggcctaatcctcatcaaggtgttttgcgatattgatcagtctagcagtaggttttgaaacaaattagaacaagaaacagaatcaaatatatggat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51990685 |
caaagggcctaatcctcatcaaggtgttttgcgatattgatcagtctagcagtaggttttgaaacaaattagaacaagaaacagaatcaaatatatggat |
51990784 |
T |
 |
| Q |
117 |
gatgctgagatttagtaatgtgtttgttttggtaataagaacaagaacatgaaaatcactttatacctatttt |
189 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51990785 |
gatgctgagatttagtaatatgtttgttttggtaataagaacaagaacatgaaaatcactttatacctatttt |
51990857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 17 - 91
Target Start/End: Complemental strand, 51996010 - 51995936
Alignment:
| Q |
17 |
caaagggcctaatcctcatcaaggtgttttgcgatattgatcagtctagcagtaggttttgaaacaaattagaac |
91 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||||||| ||||||| | |||| | |||||||||| |
|
|
| T |
51996010 |
caaagagcctaatcctcatcaaagtgttttgcgatattcatcagtctcgcagtagatattgatataaattagaac |
51995936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University