View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3871_low_8 (Length: 271)
Name: NF3871_low_8
Description: NF3871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3871_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 24336849 - 24336596
Alignment:
| Q |
1 |
agtttgcattatcaatttcttccatttttggaaatatcaaccttttatcattggtcaatgaatttcttttggtattgatcaatattggatttggtgagcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
24336849 |
agtttgcattatcaatttcttccatttttggaaatatcaaccttttatcattggtcaatgaatttcttttggtattgatcaatattggatttggtgaacc |
24336750 |
T |
|
| Q |
101 |
aaatacttcaagtgattttcttggtgtcttttctccatctaatggattttgcatttgaacaagatgatttcttgagttagaagccaaactattcttttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24336749 |
aaatacttcaagtgattttcttggtgtcttttctccatctaatggattttgcatttgaacaagatgatttcttgagttagaagccaaactattcttttca |
24336650 |
T |
|
| Q |
201 |
ttgtttaatcctacccttaacttctcttgcttttcaaagtaaacatctttattg |
254 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24336649 |
ttgttcaatcctacccttaacttctcttgcttttgaaagtaaacatctttattg |
24336596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University