View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3872_high_12 (Length: 396)

Name: NF3872_high_12
Description: NF3872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3872_high_12
NF3872_high_12
[»] chr3 (2 HSPs)
chr3 (32-203)||(3752296-3752467)
chr3 (227-378)||(3752073-3752224)
[»] chr4 (2 HSPs)
chr4 (282-370)||(25511341-25511429)
chr4 (137-196)||(25511169-25511227)
[»] chr1 (2 HSPs)
chr1 (282-370)||(31985245-31985333)
chr1 (137-196)||(31985447-31985505)
[»] chr7 (1 HSPs)
chr7 (153-192)||(26604316-26604355)


Alignment Details
Target: chr3 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 32 - 203
Target Start/End: Complemental strand, 3752467 - 3752296
Alignment:
32 accaacaccaaaccctagtagtgacaacactaacagtaacagcagcagcagtacaaagtgttttcagaattcagattgannnnnnncttgtcaaatgtat 131  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||    
3752467 accaacaccaaaccctagtagtgacaacactaacagtaacagcagcagcagtacaaagtgttttcagaattcagattgatttttttcttgtcaaatgtat 3752368  T
132 taggctctcctacttcttctatgagatttgtcttttctcttccatcttcatagatgaatgaagtgttgcttg 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
3752367 taggctctcctacttcttctatgagatttgtcttttctcttccatcttcatcgatgaatgaagtgttgcttg 3752296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 227 - 378
Target Start/End: Complemental strand, 3752224 - 3752073
Alignment:
227 agtgtgatgcaatgcaactctcccgaactttgatttttgcagccagcgtccatgtaaaaaaccggttcggttgaaaagccaccgagtccccggttcgaca 326  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
3752224 agtgcgatgcaatgcaactctcccgaactttgatttttgcagccagcgtccatgtaaaaaaccggtttggttgaaaagccaccgagtccccggttcgaca 3752125  T
327 gaaaaccggccggttcatactggttcatcacggttcaattgcatgctctatc 378  Q
    |||||||||||||||||||||||||| ||||||||||||||||||| |||||    
3752124 gaaaaccggccggttcatactggttcgtcacggttcaattgcatgccctatc 3752073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 49; Significance: 6e-19; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 282 - 370
Target Start/End: Original strand, 25511341 - 25511429
Alignment:
282 aaaaaaccggttcggttgaaaagccaccgagtccccggttcgacagaaaaccggccggttcatactggttcatcacggttcaattgcat 370  Q
    |||||||||||  | || |||| |||||||||| |||||| ||||| |||||||||||||||||| ||||| |||||||||||||||||    
25511341 aaaaaaccggtctgatttaaaaaccaccgagtcaccggtttgacaggaaaccggccggttcataccggttcgtcacggttcaattgcat 25511429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 137 - 196
Target Start/End: Original strand, 25511169 - 25511227
Alignment:
137 tctcctacttcttctatgagatttgtcttttctcttccatcttcatagatgaatgaagtg 196  Q
    |||||| |||||| | |||||||||| ||||||||||||||||||||| ||||| |||||    
25511169 tctcctccttcttatctgagatttgt-ttttctcttccatcttcatagttgaataaagtg 25511227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 282 - 370
Target Start/End: Complemental strand, 31985333 - 31985245
Alignment:
282 aaaaaaccggttcggttgaaaagccaccgagtccccggttcgacagaaaaccggccggttcatactggttcatcacggttcaattgcat 370  Q
    |||||||||||  | || |||| |||||||||| |||||| ||||| |||||||||||||||||| ||||| ||||||||||| |||||    
31985333 aaaaaaccggtctgatttaaaaaccaccgagtcaccggtttgacaggaaaccggccggttcataccggttcgtcacggttcaactgcat 31985245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 137 - 196
Target Start/End: Complemental strand, 31985505 - 31985447
Alignment:
137 tctcctacttcttctatgagatttgtcttttctcttccatcttcatagatgaatgaagtg 196  Q
    |||||| |||||| | |||||||||| ||||||||||||||||||||| ||||| |||||    
31985505 tctcctccttcttatctgagatttgt-ttttctcttccatcttcatagttgaataaagtg 31985447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 153 - 192
Target Start/End: Original strand, 26604316 - 26604355
Alignment:
153 tgagatttgtcttttctcttccatcttcatagatgaatga 192  Q
    |||||||||||||||||||||||||||||||| |||||||    
26604316 tgagatttgtcttttctcttccatcttcatagttgaatga 26604355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University