View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3872_high_13 (Length: 378)
Name: NF3872_high_13
Description: NF3872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3872_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 9e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 34033626 - 34033843
Alignment:
| Q |
17 |
cattccactatcgtagctttcgccatcggcaaaaggttcaatccttcgctgtttattttaatggaaattgttgattaatgtaatgnnnnnnnnnnnnnga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
34033626 |
cattccactatcgtagctttcgccatcggcaaaaggttcaatccttcgctgtttattttaatggaaattgttgattaatgcaatgtttttcattttttga |
34033725 |
T |
|
| Q |
117 |
atttcattatcagatttgttggtggaaatggatttcacatagttggtgctcataccgatagtccttgcttgaaactgaagccagtgtcgaaggtaattaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34033726 |
atttcattatcagatttgttggtggaaatggatttcacatagttggtgcacataccgatagtccttgcttgaaactgaagccagtgtcgaaggtaattaa |
34033825 |
T |
|
| Q |
217 |
ttcattgtttgattaatt |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34033826 |
ttcattgtttgattaatt |
34033843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 242 - 370
Target Start/End: Original strand, 34033889 - 34034005
Alignment:
| Q |
242 |
tctcacattatcgatactctaaaatgattaccggaaccggaaacggaaacctgaattgcaaaatgttacaatatcaacagagggatgaatttgattaata |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34033889 |
tctcacattatcgatactctaaaatgattaccgga------------aacctgaattgcaaaatgttacaatatcaacagagggatgaatttgattaata |
34033976 |
T |
|
| Q |
342 |
ttttgcaattttagggatcattctagaat |
370 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34033977 |
ttttgcaattttagggatcattctagaat |
34034005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 316 - 352
Target Start/End: Complemental strand, 12241446 - 12241410
Alignment:
| Q |
316 |
caacagagggatgaatttgattaatattttgcaattt |
352 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12241446 |
caacagagggatgaatttgattaaaattttgcaattt |
12241410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 322 - 363
Target Start/End: Complemental strand, 33920641 - 33920600
Alignment:
| Q |
322 |
agggatgaatttgattaatattttgcaattttagggatcatt |
363 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||||| |
|
|
| T |
33920641 |
agggatgaatatgattaagattttgcaatttcagggatcatt |
33920600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University