View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3872_high_31 (Length: 250)
Name: NF3872_high_31
Description: NF3872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3872_high_31 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 14801312 - 14801551
Alignment:
| Q |
11 |
gatgaagtggtgatggtgtatcattctcttgtatgtggatgatttattttctctctctttttcttttactgttatcaatacaattacttacagtagaaat |
110 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14801312 |
gatgaattggtgatggtgtaccattctcttgtatgtggatgatttagtttctctctctttttcttttactgttatcaatacaattacttacagtagaaat |
14801411 |
T |
|
| Q |
111 |
catgaattgaaaacctagagggaagacgtgctttcgataggtaatgaccacagtgtgacctagtttgccacattatgagcacaccgttgaatttcattct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14801412 |
catgaattgaaaacctagagggaagacgtgctttcgataggtaatgaccgcagtgtgacctagtttgccacattatgagcacaccgttgaatttcattct |
14801511 |
T |
|
| Q |
211 |
cctcgcccagcagatccactaaagtttcaactggatccac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14801512 |
cctcgcccagcagatccactaaagtttcaactggatccac |
14801551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University