View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3872_low_18 (Length: 350)
Name: NF3872_low_18
Description: NF3872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3872_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 30 - 326
Target Start/End: Original strand, 3553473 - 3553769
Alignment:
| Q |
30 |
atgttgttcagagccttgactgttaacttgatcctgcagagctctgtcttcatatccgtgtttgacttcagatcagactttgacttcataacttgatgta |
129 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3553473 |
atgttgttcagagccttgactattaacttgatcctgcagagctctgtcttcagatccgtgtttgacttcagatcagagtttgacttcataacttgatgta |
3553572 |
T |
 |
| Q |
130 |
aatttggtaaaagatttaaccttttgttgatcatcttcaaatcagagctttgtcacaagaggctttgtcttggatccagcactataacgatgatgttaat |
229 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3553573 |
aatttggtaaaagatttaaccttttgtcgatcatcttcaaatcagagctttgtcacaagaggctttgtcttggatccagcactataacgatgatgttaat |
3553672 |
T |
 |
| Q |
230 |
aatagagtagtatttggagttgagtaatagggatctagatgtggtgtagtatttggagtttcttggagtgattttagctcattgtattcacgttgta |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3553673 |
aatagagtagtatttggagttgagtaatagggatctagatgtggtgtagtatttggagtttcttggagtgattttaactcattgtattcacgttgta |
3553769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 184
Target Start/End: Original strand, 10252634 - 10252728
Alignment:
| Q |
90 |
tttgacttcagatcagactttgacttcataacttgatgtaaatttggtaaaagatttaaccttttgttgatcatcttcaaatcagagctttgtca |
184 |
Q |
| |
|
|||| |||||||||||| ||| |||||||||||||| | | ||| | | || ||| || ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
10252634 |
tttgccttcagatcagagcttgttttcataacttgatgcacacttgattagagctttgactttttgttcatcatcttcagatcagagctttgtca |
10252728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University