View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3872_low_21 (Length: 304)
Name: NF3872_low_21
Description: NF3872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3872_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 260
Target Start/End: Complemental strand, 3305762 - 3305524
Alignment:
| Q |
18 |
atcattgcttggtaaaacaattcatgcagcaccttgttcaatttccataatcctacttaaactacaaatggtacgtatcatagctagtaatttaattgct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3305762 |
atcattgcttggtaaaacaattcatgcagcaccttgttcaatttccataatcctacttaaactacaaatggtacgtatcatagctagtaatttaattgct |
3305663 |
T |
 |
| Q |
118 |
tatgctaaccgttgccacaatatattatatatgcagcatctataatgattctggatctgatcaaaatctttattaattatagtattcttcttatattatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3305662 |
tatgctaaccgttgccacaatatattatatatgcagcatctataatgattctggatctcatcaaaatcttt----attatagtattcttcttatattatt |
3305567 |
T |
 |
| Q |
218 |
gatctatttgtcaaatgtgattgtggacttttaatgcagattc |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3305566 |
gatctatttgtcaaatgtgattgtggacttttaatgcagattc |
3305524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University