View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3872_low_26 (Length: 275)
Name: NF3872_low_26
Description: NF3872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3872_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 14 - 270
Target Start/End: Original strand, 39802880 - 39803136
Alignment:
| Q |
14 |
agaatagccatcaacatggacccaacaactcctagaacatttgacaatgtttactacaaaaatcttcaacaaggaaaaggtttatttacttctgatcaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39802880 |
agaatagccatcaacatggacccaacaactcctagaacatttgacaatgtttactacaaaaatcttcaacaaggaaaaggtttatttacttctgatcaaa |
39802979 |
T |
|
| Q |
114 |
tcctcttcactgacacaagatcaaggaacactgttaactctttcgcgactaacggtaacgttttcaatgccaatttcatcactgccatgaccaagttggg |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39802980 |
tcctcttcactgatacaagatcaaggaacactgttaactctttcgcgactaacggtaacgttttcaatgccaatttcatcactgccatgaccaagttggg |
39803079 |
T |
|
| Q |
214 |
tcgtgttggagttaaaaatgcgagaaatgggaaaattcgtaccgattgttctgtgct |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39803080 |
tcgtgttggagttaaaaatgcgagaaatgggaaaattcgtaccgattgttctgtgct |
39803136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University