View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3872_low_27 (Length: 269)
Name: NF3872_low_27
Description: NF3872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3872_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 11 - 254
Target Start/End: Original strand, 44582888 - 44583131
Alignment:
| Q |
11 |
gatgaatcaagtattgcagttgctggagcaagaggtcatgtcgccttgtccaagtgaattttacgagtcccattcagatcactgataatggctaatgtgt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44582888 |
gatgaatcaagtattgcagttgctggagcaagaggtcatgtcgccttgtccaagtgaattttacgagtcccattcagatcactgataatggctaatgtgt |
44582987 |
T |
|
| Q |
111 |
tccttccccctgtttcgtggcttggttttgtagaaaagttttgtaccaaatgtgtaacaaccatttgtaaatagattttctccttgtccnnnnnnnnnnn |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44582988 |
tccttccccctgtttcgtggcttggttttgtagaaaagttttgtaccaaatgtgtaacaaccatttgtaaatagattttctccttgtccaaaacaaaacc |
44583087 |
T |
|
| Q |
211 |
nnnnnnnggacaacgtggagatggcaatggttttttgtatttgg |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44583088 |
aaaaaaaggacaacgtggagatggcaatggttttttgtatttgg |
44583131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University