View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3872_low_30 (Length: 251)

Name: NF3872_low_30
Description: NF3872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3872_low_30
NF3872_low_30
[»] chr1 (1 HSPs)
chr1 (1-208)||(52034802-52035009)


Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 52035009 - 52034802
Alignment:
1 gttgacaaattcaaactaatattgtaggacttttatcgctcaagacattgcctttcacaccaggggaagttgatgcagttttctcagacttccttcaaaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
52035009 gttgacaaattcaaactaatattgtaggacttttatcgctcaagacattgcctttcacgccaggggaagttgatgcagttttctcagacttccttcaaaa 52034910  T
101 cattgaggacatggatgaattgggaggatgtcatccgtgtgatcaatttctgcataattataactttcaaaaactataatccttagctaggaaaaaatcc 200  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52034909 cattgaggaaatggatgaattgggaggatgtcatccgtgtgatcaatttctgcataattataactttcaaaaactataatccttagctaggaaaaaatcc 52034810  T
201 atcttctc 208  Q
    ||||||||    
52034809 atcttctc 52034802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University