View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3872_low_34 (Length: 248)
Name: NF3872_low_34
Description: NF3872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3872_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 7 - 208
Target Start/End: Original strand, 14801642 - 14801843
Alignment:
| Q |
7 |
tagataatactttgttcatattaggaaaacgcttccatttacaataataaacaatttaagaagctccatttgcaataattgtgatcacacagccacataa |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14801642 |
tagaaaatactttgttcatattaggaaaacgcttccatttacaataataaacaatttaagaagctccatttgcaataattgtgatcacacagccacataa |
14801741 |
T |
|
| Q |
107 |
gactcatttaatctcataaggattgaatttttattcaagttctgctttggttttgattcaatttttgttgttgatcataacggtattttgcctggtactt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14801742 |
gactcatttaatctcataaggattgaatttttattcaagttctgctttggttttgattcaatttttgttgttgatcataacggtattttgcctggtactt |
14801841 |
T |
|
| Q |
207 |
aa |
208 |
Q |
| |
|
|| |
|
|
| T |
14801842 |
aa |
14801843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University