View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3872_low_37 (Length: 237)
Name: NF3872_low_37
Description: NF3872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3872_low_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 52035311 - 52035534
Alignment:
| Q |
1 |
tcttatccaatttcgtcaaagataatgttctgaatttgcagagaggaaggggattgttggacagagaccgagtaacaatgctattttgttaaagttacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035311 |
tcttatccaatttcgtcaaagataatgttttgaatttgcagagaggaaggggattgttggacagagaccgagtaacaatgctattttgttaaagttacaa |
52035410 |
T |
|
| Q |
101 |
taagttgaaattgatttctaatgtttgtctagatgtccaaccaacaatgtcaagcttttcttaacataactcacctcgagcttcggcttatctttgtacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035411 |
taagttgaaattgatttctaatgtttgtctagatgtccaaccaacaatgtcaagcttttcttaacataactcacctcgagcttcggcttatctttgtacc |
52035510 |
T |
|
| Q |
201 |
cccttgaactgcttgatcaaagtg |
224 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
52035511 |
cacttgaactgcttgatcaaagtg |
52035534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University