View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3873_high_1 (Length: 436)
Name: NF3873_high_1
Description: NF3873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3873_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 378; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 378; E-Value: 0
Query Start/End: Original strand, 20 - 429
Target Start/End: Original strand, 44314184 - 44314584
Alignment:
| Q |
20 |
cgagcttgttacgtatcttactaatataatcagaagccaatccatcaacacaaagctctttatttggattaacatcgtgaagtctctctttatggatcaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44314184 |
cgagcttgttacgtatcttactaatataatcagaagccaatccatcaacacaaagctctttatttggattaacatcgtgaagtctctctttatggatcaa |
44314283 |
T |
 |
| Q |
120 |
atactccgttgatcggttgcttccaactgacttgataacatacgtagggtttgcgcggctctgcggctgttgtgaccttctactgcttgctggaaattgc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44314284 |
atactccgttgatcggttgcttccaactgacttgataacatacgtagggtttgcgcggctctgcggctgttgtgaccttctactgcttgctggaaattgc |
44314383 |
T |
 |
| Q |
220 |
ttattagaaaccaatttttccttcataggttccttctcagaataatcagaatctgaaagatccttatccttccttgattttctagtagtagaagctccaa |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44314384 |
ttattagaaaccaatttttccttcataggttccttc---------tcagaatctgaaagatccttatccttccttgattttctagtagtagaagctccaa |
44314474 |
T |
 |
| Q |
320 |
ctccaagggtcctttgtgcaatagagaaagaggataaccttatgacatttactacaaccttcattgatttctcacaaagagattcctcattcttggactt |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44314475 |
ctccaagggtcctttgtgcaatagagaaagaggataaccttatgacatttactacaaccttcattgatttctcacaaagagattcctcattcttggactt |
44314574 |
T |
 |
| Q |
420 |
tcctatgcta |
429 |
Q |
| |
|
|||||||||| |
|
|
| T |
44314575 |
tcctatgcta |
44314584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University