View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3873_high_2 (Length: 225)

Name: NF3873_high_2
Description: NF3873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3873_high_2
NF3873_high_2
[»] chr3 (1 HSPs)
chr3 (1-42)||(8521835-8521876)


Alignment Details
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 8521835 - 8521876
Alignment:
1 ttataaaattgtaaaatttcttgtaaaatgggtaaatgatcg 42  Q
    |||||||||||||||||||||||||||||  |||||||||||    
8521835 ttataaaattgtaaaatttcttgtaaaatctgtaaatgatcg 8521876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University